Mature sequence ssc-miR-371-5p

Accession numberMIMAT0037081
IDssc-miR-371-5p
Stem-Loop ssc-mir-371
Sequence
acucaaacugugggggcacuuu
Get sequence
Deep sequencing1 reads, 1 experiments

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).