Mature sequence mdm-miR171f-5p

Accession numberMIMAT0037467
IDmdm-miR171f-5p
Stem-Loop mdm-MIR171f
Sequence
ggauauugguccgguucaaua
Get sequence
Deep sequencing reads, experiments

References

1
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).
2
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).