Mature sequence gma-miR10197

Accession numberMIMAT0040964
IDgma-miR10197
Stem-Loop gma-MIR10197
Sequence
auuuuagaacgacuuuuuccu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:25465409 "An atlas of soybean small RNAs identifies phased siRNAs from hundreds of coding genes" Arikit S, Xia R, Kakrana A, Huang K, Zhai J, Yan Z, Valdes-Lopez O, Prince S, Musket TA, Nguyen HT, Stacey G, Meyers BC Plant Cell. 26:4584-4601(2014).
2