Mature sequence gma-miR399j

Accession numberMIMAT0041664
IDgma-miR399j
Stem-Loop gma-MIR399j
Sequence
ugccaaaggagauuugcccug
Get sequence
Deep sequencing reads, experiments

References

1