Mature sequence gma-miR169w

Accession numberMIMAT0041676
IDgma-miR169w
Stem-Loop gma-MIR169w
Sequence
caaggaugacuugccggcauu
Get sequence
Deep sequencing reads, experiments

References

1