Mature sequence sly-miR7981c

Accession numberMIMAT0042021
IDsly-miR7981c
Stem-Loop sly-MIR7981c
Sequence
ucgaaaucucagagacacacuuau
Get sequence
Deep sequencing reads, experiments

References

1