Mature sequence sly-miR6025

Accession numberMIMAT0042023
IDsly-miR6025
Stem-Loop sly-MIR6025
Sequence
uaccaauaauugagauaacauc
Get sequence
Deep sequencing reads, experiments

References

1