Mature sequence sly-miR169f

Accession numberMIMAT0042028
IDsly-miR169f
Stem-Loop sly-MIR169f
Sequence
uaggcguugucugaggcuaac
Get sequence
Deep sequencing reads, experiments

References

1