Mature sequence mdm-miR319g

Accession numberMIMAT0043569
IDmdm-miR319g
Stem-Loop mdm-MIR319g
Sequence
gagcuuucuucaguccacuc
Get sequence
Deep sequencing reads, experiments

References

1
"Identification of apple miRNAs and their potential role in fire blight resistance" Kaja E, Szczesniak MW, Jensen PJ, Axtell MJ, McNellis T, Makalowska I Trees Genet Genomes. 11:812(2014).