Mature sequence mes-miR477j

Accession numberMIMAT0045973
IDmes-miR477j
Stem-Loop mes-MIR477j
Sequence
acucucccuaaaggcuucaac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).