Mature sequence pte-iab-4-3p

Accession numberMIMAT0046078
IDpte-iab-4-3p
Stem-Loop pte-iab-4-1
Sequence
cgguauaccuucaguauacguaac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).