Mature sequence bta-miR-2285bn

Accession numberMIMAT0046625
IDbta-miR-2285bn
Stem-Loop bta-mir-2285bn
Sequence
aaaaccugaaugaacuuuuugu
Get sequence
Deep sequencing10653 reads, 77 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).