Mature sequence bta-miR-2285df

Accession numberMIMAT0046729
IDbta-miR-2285df
Stem-Loop bta-mir-2285df
Sequence
aaaaaccugaacagacuuuugg
Get sequence
Deep sequencing82 reads, 24 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).