Mature sequence mmu-miR-1271-5p

Accession numberMIMAT0048641
IDmmu-miR-1271-5p
Stem-Loop mmu-mir-1271
Sequence
cuuggcaccugguaagcacuca
Get sequence
Deep sequencing1 reads, 1 experiments

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).