Mature sequence gga-miR-210b-3p

Accession numberMIMAT0050055
IDgga-miR-210b-3p
Stem-Loop gga-mir-210b
Sequence
augugcguuagucaguggcuc
Get sequence
Deep sequencing18 reads, 2 experiments

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).