![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence cel-lin-4 |
|||||
Accession | MI0000002 (change log) | ||||
Previous IDs | cel-lin-4L | ||||
Description | Caenorhabditis elegans lin-4 stem-loop | ||||
Gene family | MIPF0000303; lin-4 | ||||
Literature search |
![]()
49 open access papers mention cel-lin-4 | ||||
Stem-loop |
--a --- g -uu u c a u - u 5' ugcuu ccg ccug ccc gaga cuca gugugag gua c a ||||| ||| |||| ||| |||| |||| ||||||| ||| | 3' acgag ggc ggac ggg cucu gggu cacacuu cgu g u uag uuu a cau c c c - a u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
lin-4 is found on chromosome II in Caenorhabditis elegans [1] and is complementary to sequences in the 3' untranslated region (UTR) of lin-14 mRNA. lin-4 acts to developmentally repress the accumulation of lin-14 protein. This repression is essential for the proper timing of numerous events of Caenorhabditis elegans larval development [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence cel-lin-4-5p |
|
Accession | MIMAT0000002 |
Previous IDs | cel-lin-4 |
Sequence |
16 - ucccugagaccucaaguguga - 36 |
Deep sequencing | 436802 reads, 16 experiments |
Evidence | experimental; cloned [1,3-4], 454 [5], Illumina [6], CLIPseq [7] |
Database links |
|
Predicted targets |
|
Mature sequence cel-lin-4-3p |
|
Accession | MIMAT0015092 |
Previous IDs | cel-lin-4* |
Sequence |
55 - acaccugggcucuccggguacc - 76 |
Deep sequencing | 85 reads, 11 experiments |
Evidence | experimental; CLIPseq [7] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:11679671
"An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans"
Science. 294:858-862(2001).
|
2 | |
3 |
PMID:12672692
"The microRNAs of Caenorhabditis elegans"
Genes Dev. 17:991-1008(2003).
|
4 |
PMID:12747828
"MicroRNAs and other tiny endogenous RNAs in C. elegans"
Curr Biol. 13:807-818(2003).
|
5 |
PMID:17174894
"Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans"
Cell. 127:1193-1207(2006).
|
6 | |
7 |
PMID:20062054
"Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans"
Nat Struct Mol Biol. 17:173-179(2010).
|