Stem-loop sequence cel-lin-4

AccessionMI0000002 (change log)
Previous IDscel-lin-4L
DescriptionCaenorhabditis elegans lin-4 stem-loop
Gene family MIPF0000303; lin-4
Literature search

49 open access papers mention cel-lin-4
(379 sentences)

Stem-loop 
   --a     ---   g    -uu   u    c    a       u   - u 
5'    ugcuu   ccg ccug   ccc gaga cuca gugugag gua c a
      |||||   ||| ||||   ||| |||| |||| ||||||| ||| |  
3'    acgag   ggc ggac   ggg cucu gggu cacacuu cgu g u
   uag     uuu   a    cau   c    c    c       -   a u
Get sequence
Deep sequencing
436890 reads, 1.89e+03 reads per million, 16 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

lin-4 is found on chromosome II in Caenorhabditis elegans [1] and is complementary to sequences in the 3' untranslated region (UTR) of lin-14 mRNA. lin-4 acts to developmentally repress the accumulation of lin-14 protein. This repression is essential for the proper timing of numerous events of Caenorhabditis elegans larval development [2].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 5902254-5902347 [+]
sense
F59G1.4 ; F59G1.4; intron 9
antisense
F59G1.10 ; F59G1.10; exon 1
Database links

Mature sequence cel-lin-4-5p

Accession MIMAT0000002
Previous IDscel-lin-4
Sequence

16 -  

ucccugagaccucaaguguga

 - 36

Get sequence
Deep sequencing436802 reads, 16 experiments
Evidence experimental; cloned [1,3-4], 454 [5], Illumina [6], CLIPseq [7]
Database links
Predicted targets

Mature sequence cel-lin-4-3p

Accession MIMAT0015092
Previous IDscel-lin-4*
Sequence

55 -  

acaccugggcucuccggguacc

 - 76

Get sequence
Deep sequencing85 reads, 11 experiments
Evidence experimental; CLIPseq [7]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:10642801 "The lin-4 regulatory RNA controls developmental timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after the initiation of translation" Olsen PH, Ambros V Dev Biol. 216:671-680(1999).
3
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
4
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
5
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
6
PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
7
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).