Stem-loop sequence cel-mir-39

Accession

MI0000010 (change log)

Description

Caenorhabditis elegans miR-39 stem-loop

Gene family

MIPF0000304; mir-39

Literature search

4 open access papers mention cel-mir-39
(17 sentences)

Stem-loop

   u     g      c         -  u      a    g    u 
5'  auacc agagcc agcugauuu cg cuuggu auaa cucg c
    ||||| |||||| ||||||||| || |||||| |||| ||||  
3'  ugugg ucucgg ucgacuaaa gu gggcca uauu gagu a
   c     -      u         u  -      c    a    u 

Deep sequencing

2057391 reads, 1.21e+04 reads per million, 17 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The excised miRNA sequence was initially predicted [1], and confirmed later by sequencing [3].

Genome context

• Coordinates (WBcel235; GCA_000002985.3): chrII: 11538089-11538175 [+]
• Overlapping transcripts:

  sense

  Y62F5A.15 ; Y62F5A.15; exon 1

  antisense

  Y62F5A.9 ; Y62F5A.9; intron 2

Clustered miRNAs

< 10kb from cel-mir-39

• cel-mir-35: chrII: 11537608-11537704 [+]
• cel-mir-36: chrII: 11537713-11537809 [+]
• cel-mir-37: chrII: 11537833-11537930 [+]
• cel-mir-38: chrII: 11537933-11538027 [+]
• cel-mir-39: chrII: 11538089-11538175 [+]
• cel-mir-40: chrII: 11538184-11538275 [+]
• cel-mir-41: chrII: 11538308-11538404 [+]

Database links

• RNAcentral:URS0000445DF7_6239
• miRBase Tracker:MI0000010

Mature sequence cel-miR-39-5p

• Accession: MIMAT0020306
• Previous IDs: cel-miR-39*
• Sequence: 15 - agcugauuucgucuugguaaua - 36
• Deep sequencing: 18769 reads, 17 experiments
• Evidence: experimental; Illumina [6]
• Database links:
  • RNAcentral:URS000016D303_6239

Mature sequence cel-miR-39-3p

• Accession: MIMAT0000010
• Previous IDs: cel-miR-39
• Sequence: 55 - ucaccggguguaaaucagcuug - 76
• Deep sequencing: 2038619 reads, 17 experiments
• Evidence: experimental; Northern [1], cloned [2], 454 [3], Illumina [4,6], CLIPseq [5]
• Database links:
  • RNAcentral:URS00005D4EC7_6239
• Predicted targets:
  • TargetScanWorm:cel-miR-39
  • microrna.org:cel-miR-39-3p

References

1. PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2. PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3. PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4. PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
5. PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6. PMID:21307183 "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" Warf MB, Johnson WE, Bass BL RNA. 17:563-577(2011).