![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence cel-mir-43 |
||||||||||
Accession | MI0000014 (change log) | |||||||||
Description | Caenorhabditis elegans miR-43 stem-loop | |||||||||
Gene family | MIPF0000234; mir-43 | |||||||||
Literature search |
2 open access papers mention cel-mir-43 | |||||||||
Stem-loop |
-ua ug uagu u - a u - aaa 5' u gcac cgcccgugaca caag aaacu gugau aug cc c | |||| ||||||||||| |||| ||||| ||||| ||| || c 3' a cgug gcgggcgcugu guuc uuuga cacua uac gg a uug gu ---- c a - - a gac |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: high
| |||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
|
Mature sequence cel-miR-43-5p |
|
Accession | MIMAT0020308 |
Previous IDs | cel-miR-43* |
Sequence |
21 - gacaucaagaaacuagugauuaug - 44 |
Deep sequencing | 232 reads, 15 experiments |
Evidence | experimental; Illumina [7] |
Database links |
|
Mature sequence cel-miR-43-3p |
|
Accession | MIMAT0000014 |
Previous IDs | cel-miR-43 |
Sequence |
61 - uaucacaguuuacuugcugucgc - 83 |
Deep sequencing | 5198 reads, 15 experiments |
Evidence | experimental; cloned [1-4], Northern [1], 454 [5], Illumina [6-7] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:11679671
"An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans"
Science. 294:858-862(2001).
|
2 |
PMID:11679672
"An extensive class of small RNAs in Caenorhabditis elegans"
Science. 294:862-864(2001).
|
3 |
PMID:12672692
"The microRNAs of Caenorhabditis elegans"
Genes Dev. 17:991-1008(2003).
|
4 |
PMID:12747828
"MicroRNAs and other tiny endogenous RNAs in C. elegans"
Curr Biol. 13:807-818(2003).
|
5 |
PMID:17174894
"Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans"
Cell. 127:1193-1207(2006).
|
6 | |
7 |