Stem-loop sequence cel-mir-50

Accession

MI0000021 (change log)

Description

Caenorhabditis elegans miR-50 stem-loop

Gene family

MIPF0000266; mir-50

Literature search

3 open access papers mention cel-mir-50
(14 sentences)

Stem-loop

   ------      -        c               ucu       g   uu 
5'       cugccc gccggccg ugauaugucugguau   uggguuu aac  c
         |||||| |||||||| |||||||||||||||   ||||||| |||  c
3'       gacggg cggccggc gcuaugcagauuaua   gcccaag uug  a
   guaaug      g        a               --c       -   cg 

Deep sequencing

90221 reads, 459 reads per million, 17 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [3].

Genome context

• Coordinates (WBcel235; GCA_000002985.3): chrI: 1738635-1738733 [+]
• Overlapping transcripts:

  sense

  Y71G12B.11c ; Y71G12B.11c; intron 4

  Y71G12B.11a ; Y71G12B.11a; intron 8

  antisense

  Y71G12B.36 ; Y71G12B.36; exon 1

Database links

• RNAcentral:URS00004CE0DF_6239
• miRBase Tracker:MI0000021

Mature sequence cel-miR-50-5p

• Accession: MIMAT0000021
• Previous IDs: cel-miR-50
• Sequence: 16 - ugauaugucugguauucuuggguu - 39
• Deep sequencing: 89826 reads, 17 experiments
• Evidence: experimental; cloned [1-2], 454 [3], Illumina [4,6], CLIPseq [5]
• Database links:
  • RNAcentral:URS000028F175_6239
• Predicted targets:
  • TargetScanWorm:cel-miR-50
  • microrna.org:cel-miR-50-5p

Mature sequence cel-miR-50-3p

• Accession: MIMAT0020310
• Previous IDs: cel-miR-50*
• Sequence: 58 - cccgcauauuagacguaucgac - 79
• Deep sequencing: 388 reads, 11 experiments
• Evidence: experimental; Illumina [6]
• Database links:
  • RNAcentral:URS00001379A0_6239

References

1. PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2. PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3. PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4. PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
5. PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6. PMID:21307183 "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" Warf MB, Johnson WE, Bass BL RNA. 17:563-577(2011).