![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence cel-mir-62 |
|||||
Accession | MI0000033 (change log) | ||||
Description | Caenorhabditis elegans miR-62 stem-loop | ||||
Gene family | MIPF0000296; mir-62 | ||||
Literature search |
![]()
2 open access papers mention cel-mir-62 | ||||
Stem-loop |
-- cu -c c 5' gugaguuagau cauauc uuccg a ||||||||||| |||||| ||||| a 3' cauucgaucua guauag aaggu a ga au ua a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence cel-miR-62 |
|
Accession | MIMAT0000034 |
Sequence |
37 - ugauauguaaucuagcuuacag - 58 |
Deep sequencing | 17175 reads, 15 experiments |
Evidence | experimental; cloned [1-3], 454 [4], Illumina [6], CLIPseq [7] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:11679671
"An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans"
Science. 294:858-862(2001).
|
2 |
PMID:11679672
"An extensive class of small RNAs in Caenorhabditis elegans"
Science. 294:862-864(2001).
|
3 |
PMID:12672692
"The microRNAs of Caenorhabditis elegans"
Genes Dev. 17:991-1008(2003).
|
4 |
PMID:17174894
"Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans"
Cell. 127:1193-1207(2006).
|
5 |
PMID:17589500
"Intronic microRNA precursors that bypass Drosha processing"
Nature. 448:83-86(2007).
|
6 | |
7 |
PMID:20062054
"Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans"
Nat Struct Mol Biol. 17:173-179(2010).
|