Stem-loop sequence cel-mir-79

AccessionMI0000050 (change log)
DescriptionCaenorhabditis elegans miR-79 stem-loop
Gene family MIPF0000014; mir-9
Literature search

4 open access papers mention cel-mir-79
(4 sentences)

Stem-loop 
   ua     -  -uu u    u          uc     ca    --uu   u 
5'   guaga ca   c ccga cuuuggugau  agcuu  auga    ggc a
     ||||| ||   | |||| ||||||||||  |||||  ||||    ||| c
3'   caucu gu   g ggcu gaaaccauug  ucgaa  uacu    uug a
   --     a  ucu c    c          ga     -a    uucu   g
Get sequence
Deep sequencing
28340 reads, 4.04e+03 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 9332946-9333043 [+]
intergenic
Database links

Mature sequence cel-miR-79-5p

Accession MIMAT0020322
Previous IDscel-miR-79*
Sequence

19 -  

cuuuggugauucagcuucaauga

 - 41

Get sequence
Deep sequencing452 reads, 15 experiments
Evidence experimental; Illumina [8]
Database links

Mature sequence cel-miR-79-3p

Accession MIMAT0000051
Previous IDscel-miR-79
Sequence

61 -  

auaaagcuagguuaccaaagcu

 - 82

Get sequence
Deep sequencing27570 reads, 17 experiments
Evidence experimental; cloned [1-3], PCR [4], 454 [5], Illumina [6,8], CLIPseq [7]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
5
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
6
PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
7
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
8
PMID:21307183 "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" Warf MB, Johnson WE, Bass BL RNA. 17:563-577(2011).