miRBase entry: hsa-let-7b

Stem-loop hsa-let-7b


Accession
MI0000063
Symbol
HGNC: MIRLET7B
Description
Homo sapiens hsa-let-7b precursor miRNA
Gene family
MIPF0000002; let-7

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIRLET7B is the host gene of miR-let-7b-5p (hereafter referred to as miR-let-7b) that is augmented during oxygen exposure, causing oxidative stress and senescence in the choroid and retinal pigment epithelium through the p53–let-7b–IGF-1R axis, but the role of miR-let-7b in cell senescence remains unclear [1]. LYPLAL1-AS1 directly interacts with the MIRLET7B promoter and regulates its activity negatively [1]. FOXO3 very likely regulates the expression of MIRLET7B and MIRLET7C [2]. LYPLAL1-AS1 binds to a specific region of the MIRLET7B promoter on chromosome 22, as shown by ChIRP-seq analysis using Integrative Genomics Viewer software [1]. During dissociation-induced retinal pigment epithelial epithelial-mesenchymal transition, several microRNA host genes, including MIRLET7B, are upregulated or downregulated at different time points [3]. The transcription factor NKX2-5 positively regulates target genes MIR29C and MIRLET7B when mutated [4]. A novel conditional allele for the bicistronic mirLet7c2 and MIRLET7B miRNAs was generated using homologous recombination in mouse ES cells for targeted manipulation of these specific microRNAs [5].

References:
[1] PMC9022335
[2] PMC5695745
[3] PMC8024778
[4] PMC6566633
[5] PMC3814644

Literature search
1157 open access papers mention hsa-let-7b
(6991 sentences)

Sequence

11518188 reads, 27396 reads per million, 159 experiments
cggggUGAGGUAGUAGGUUGUGUGGUUucagggcagugauguugccccucggaagauaaCUAUACAACCUACUGCCUUCCCug
(((((.(((((((((((((((((((((((.((((((.....))))))...))).....)))))))))))))))))))))))))

Structure
     U                    -----   --a      u 
cgggg GAGGUAGUAGGUUGUGUGGU     Uuc   gggcag g
||||| ||||||||||||||||||||     |||   |||||| a
guCCC UUCCGUCAUCCAACAUAUCa     agg   cccguu u
     -                    auaga   cuc      g 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr22: 46113686-46113768 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-let-7b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-let-7b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-let-7b is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-let-7b is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-let-7b-5p

Accession MIMAT0000063
Description Homo sapiens hsa-let-7b-5p mature miRNA
Sequence 6 - UGAGGUAGUAGGUUGUGUGGUU - 27
Evidence experimental
cloned [1,3-5], Northern [1]
Database links
Predicted targets

Mature hsa-let-7b-3p

Accession MIMAT0004482
Description Homo sapiens hsa-let-7b-3p mature miRNA
Sequence 60 - CUAUACAACCUACUGCCUUCCC - 81
Evidence experimental
cloned [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  3. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  4. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  5. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043