miRBase entry: hsa-mir-96

Stem-loop hsa-mir-96


Accession
MI0000098
Symbol
HGNC: MIR96
Description
Homo sapiens hsa-mir-96 precursor miRNA
Gene family
MIPF0000072; mir-96

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR96 is a microRNA that has been found to be associated with progressive hearing loss [PMC3259013]. Understanding the pathogenic mechanisms that connect MIR96 mutations to this condition is crucial for the development of personalized therapeutic approaches for individuals carrying these mutations [PMC3259013]. However, there is insufficient coverage of MIR96, which may limit our current knowledge about its role in hearing loss [PMC8738750]. Further research is needed to fully comprehend the impact of MIR96 mutations and to explore potential therapeutic interventions for affected individuals.

Literature search
193 open access papers mention hsa-mir-96
(1229 sentences)

Sequence

77895 reads, 613 reads per million, 122 experiments
uggccgauUUUGGCACUAGCACAUUUUUGCUugugucucuccgcucugagcAAUCAUGUGCAGUGCCAAUAUGggaaa
...((.((.((((((((.((((((..(((((((((......)))...))))))..)))))))))))))).)).))...

Structure
ugg  g  U        A      UU      ---   uc 
   cc au UUGGCACU GCACAU  UUGCUu   gug  u
   || || |||||||| ||||||  ||||||   |||   
   gg UA AACCGUGA CGUGUA  AAcgag   cgc  c
aaa  G  U        -      CU      ucu   cu 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence is localised to chromosome 7 and was named mir-96-7 in reference [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr7: 129774692-129774769 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-96
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-96 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-96-5p

Accession MIMAT0000095
Description Homo sapiens hsa-miR-96-5p mature miRNA
Sequence 9 - UUUGGCACUAGCACAUUUUUGCU - 31
Evidence experimental
cloned [1-3]
Database links
Predicted targets

Mature hsa-miR-96-3p

Accession MIMAT0004510
Description Homo sapiens hsa-miR-96-3p mature miRNA
Sequence 52 - AAUCAUGUGCAGUGCCAAUAUG - 73
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728