WARNING: This summary was generated by AI. MIR96 is a microRNA implicated in the pathogenesis of progressive hearing loss, where understanding the various pathogenic mechanisms associated with MIR96 mutations is essential for the development of personalized therapies for affected individuals [PMC3259013]. However, research into MIR96 has been hindered by inadequate sequencing coverage, which poses a challenge in fully elucidating its role in hearing impairment [PMC8738750].
ugg g U A UU --- uc cc au UUGGCACU GCACAU UUGCUu gug u || || |||||||| |||||| |||||| ||| gg UA AACCGUGA CGUGUA AAcgag cgc c aaa G U - CU ucu cu
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000095 |
| Description | Homo sapiens hsa-miR-96-5p mature miRNA |
| Sequence | 9 - UUUGGCACUAGCACAUUUUUGCU - 31 |
| Evidence |
experimental
cloned [1-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004510 |
| Description | Homo sapiens hsa-miR-96-3p mature miRNA |
| Sequence | 52 - AAUCAUGUGCAGUGCCAAUAUG - 73 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|