miRBase entry: hsa-mir-29b-1

Stem-loop hsa-mir-29b-1


Accession
MI0000105
Symbol
HGNC: MIR29B1
Description
Homo sapiens hsa-mir-29b-1 precursor miRNA
Gene family
MIPF0000009; mir-29

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR29B1 is a microRNA that has been observed to be downregulated in Alzheimer's disease (AD) patients [PMC7564652]. It has been found to target secretases, which are involved in AD pathogenesis, as well as have a protective effect on neuron survival [PMC7564652]. Additionally, MIR29B1 has been shown to regulate BACE1 expression, a gene involved in AD, in vitro [PMC7564652]. In the cortex of AD patients, MIR29B1 is downregulated along with other microRNAs such as MIR129-2, MIR1296, MIR219A1, MIR375, MIR411, and MIR431 [PMC7564652]. Conversely, microRNAs such as MIR199A2 and MIR92A1 are upregulated in the cortex of AD patients [PMC7564652]. In other contexts, such as dairy cattle domestication and breast cancer cells (MDA-MB-231S), upregulation of MIR29B1 has been observed [PMC6898964] [PMC4651668]. It is also a host gene for miR-22 and miR-29b which are downregulated in certain diseases like SMZL (splenic marginal zone lymphoma) [PMC7111612] [PMC8064455]. In rats with a homozygous mutation of the Mir29b-1/a gene that encodes nucleotides 6–9 in the sequence of mature miR-29b-3p (MIR29B1), reduced urine volume and urinary sodium excretion were observed due to reduced NO levels in the renal outer medulla [PMC6156712].

Literature search
661 open access papers mention hsa-mir-29b-1
(4447 sentences)

Sequence

369151 reads, 2447 reads per million, 159 experiments
cuucaggaaGCUGGUUUCAUAUGGUGGUUUAGAuuuaaauagugauugucUAGCACCAUUUGAAAUCAGUGUUcuuggggg
(((((((((((((((((((.((((((..((((((.............)))))))))))).)))))))))).))))))))).

Structure
-         -          U      GU      uuaaa 
 cuucaggaa GCUGGUUUCA AUGGUG  UUAGAu     u
 ||||||||| |||||||||| ||||||  ||||||     a
 gggguucUU UGACUAAAGU UACCAC  GAUcug     g
g         G          U      --      uuagu 


Annotation confidence High
Do you think this miRNA is real?
Comments
Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 [1]. Subsequent genome assemblies suggest the presence of only one miR-102 locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.

Genome context
chr7: 130877459-130877539 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-29b-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-29b-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-29b-1-5p

Accession MIMAT0004514
Description Homo sapiens hsa-miR-29b-1-5p mature miRNA
Sequence 10 - GCUGGUUUCAUAUGGUGGUUUAGA - 33
Evidence experimental
cloned [3-4]
Database links
Predicted targets

Mature hsa-miR-29b-3p

Accession MIMAT0000100
Description Homo sapiens hsa-miR-29b-3p mature miRNA
Sequence 51 - UAGCACCAUUUGAAAUCAGUGUU - 73
Evidence experimental
cloned [1-4], Northern [2]
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728