Stem-loop mmu-mir-134

Accession

MI0000160

Symbol

MGI: Mir134

Description

Mus musculus mmu-mir-134 precursor miRNA

Gene family

MIPF0000112; mir-134

Literature search

79 open access papers mention mmu-mir-134
(342 sentences)

Sequence

186746 reads, 594 reads per million, 89 experiments

agggugUGUGACUGGUUGACCAGAGGGGcgugcacucuguucaccCUGUGGGCCACCUAGUCACCaacccu
(((((..((((((((.((.(((.((((..(.(((...))).).)))).)))..)).))))))))..)))))

Structure

     gU        U  -A   G    Gc u   c 
agggu  GUGACUGG UG  CCA AGGG  g gca  
|||||  |||||||| ||  ||| ||||  | ||| u
uccca  CACUGAUC AC  GGU UCcc  c ugu  
     aC        C  CG   G    -a u   c 

Annotation confidence High

Genome context

chr12: 109734139-109734209 [+]

Clustered miRNAs

17 other miRNAs are < 10 kb from mmu-mir-134

Mature mmu-miR-134-5p

• Accession: MIMAT0000146
• Description: Mus musculus mmu-miR-134-5p mature miRNA
• Sequence: 7 - UGUGACUGGUUGACCAGAGGGG - 28
• Evidence: experimental ; cloned [1,3-4], PCR [2], Illumina [5,7]

Mature mmu-miR-134-3p

• Accession: MIMAT0016985
• Description: Mus musculus mmu-miR-134-3p mature miRNA
• Sequence: 46 - CUGUGGGCCACCUAGUCACC - 65
• Evidence: experimental ; 454 [6], Illumina [7]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


3. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


4. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


5. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


6. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275


7. PubMed ID: 15310658
   A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain
   "Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J"
   "Genome Res (2004) 14:1741-1748