![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR156b |
|||||
Accession | MI0000179 (change log) | ||||
Description | Arabidopsis thaliana miR156b stem-loop | ||||
Gene family | MIPF0000008; MIR156 | ||||
Literature search |
![]()
79 open access papers mention ath-MIR156b | ||||
Stem-loop |
- ---- u u uu -aau -a ----a - - au g cu u 5' gcuaga agagggagaga gg ga gagg gca cagaga aacugacagaa gagag ugagcac gca gca guuaug g |||||| ||||||||||| || || |||| ||| |||||| ||||||||||| ||||| ||||||| ||| ||| |||||| 3' cgguuu ucucucucucu uc cu cucc cgu gucucu uugacugucuu cucuc acucgug ugu cgu caauau u u aaac c u cu aguu cc auccg u c cg g uu c |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
MIR156b is thought to target 10 mRNAs coding for proteins containing the Squamosa-promoter Binding Protein (SBP) box [1]. The complementary sites are downstream of this conserved domain, within a poorly conserved protein-coding context or the 3' UTR [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR156b-3p |
|
Accession | MIMAT0031866 |
Sequence |
106 - ugcucaccucucuuucugucagu - 128 |
Evidence | not experimental |
References |
|
1 |
PMID:12101121
"MicroRNAs in plants"
Genes Dev. 16:1616-1626(2002).
|
2 |
PMID:12202040
"Prediction of plant microRNA targets"
Cell. 110:513-520(2002).
|
3 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
4 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
5 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
6 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|