Stem-loop sequence ath-MIR156b

AccessionMI0000179 (change log)
DescriptionArabidopsis thaliana miR156b stem-loop
Gene family MIPF0000008; MIR156
Literature search

79 open access papers mention ath-MIR156b
(752 sentences)

Stem-loop 
   -      ----           u  u  uu    -aau   -a      ----a           -     -       au   g   cu      u 
5'  gcuaga    agagggagaga gg ga  gagg    gca  cagaga     aacugacagaa gagag ugagcac  gca gca  guuaug g
    ||||||    ||||||||||| || ||  ||||    |||  ||||||     ||||||||||| ||||| |||||||  ||| |||  ||||||  
3'  cgguuu    ucucucucucu uc cu  cucc    cgu  gucucu     uugacugucuu cucuc acucgug  ugu cgu  caauau u
   u      aaac           c  u  cu    aguu   cc      auccg           u     c       cg   g   uu      c
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

MIR156b is thought to target 10 mRNAs coding for proteins containing the Squamosa-promoter Binding Protein (SBP) box [1]. The complementary sites are downstream of this conserved domain, within a poorly conserved protein-coding context or the 3' UTR [2].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 15074899-15075081 [+]
intergenic
Database links

Mature sequence ath-miR156b-5p

Accession MIMAT0000167
Previous IDsath-miR156b
Sequence

47 -  

ugacagaagagagugagcac

 - 66

Get sequence
Evidence experimental; cloned [1,3], Northern [1], 454 [4-5], MPSS [4], Illumina [6]

Mature sequence ath-miR156b-3p

Accession MIMAT0031866
Sequence

106 -  

ugcucaccucucuuucugucagu

 - 128

Get sequence
Evidence not experimental

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).