Stem-loop sequence ath-MIR156c

AccessionMI0000180 (change log)
DescriptionArabidopsis thaliana miR156c stem-loop
Gene family MIPF0000008; MIR156
Literature search

79 open access papers mention ath-MIR156c
(761 sentences)

Stem-loop 
   c  aua   a        -    -         a   ---     cuu     g 
5'  gc   gaa cugacaga agag agugagcac caa   aggca   ugcau u
    ||   ||| |||||||| |||| ||||||||| |||   |||||   ||||| u
3'  cg   cuu gacugucu ucuc ucacucgug guu   uucgu   acgua c
   u  -gc   a        a    g         c   cuc     -uu     g
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

MIR156c is thought to target 10 mRNAs coding for proteins containing the Squamosa-promoter Binding Protein (SBP) box [1]. The complementary sites are downstream of this conserved domain, within a poorly conserved protein-coding context or the 3' UTR [2].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 15415418-15415521 [-]
intergenic
Database links

Mature sequence ath-miR156c-5p

Accession MIMAT0000168
Previous IDsath-miR156c
Sequence

12 -  

ugacagaagagagugagcac

 - 31

Get sequence
Evidence experimental; cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

Mature sequence ath-miR156c-3p

Accession MIMAT0031867
Sequence

75 -  

gcucacugcucuaucugucaga

 - 96

Get sequence
Evidence not experimental

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).