Stem-loop sequence ath-MIR157b

Accession

MI0000185 (change log)

Description

Arabidopsis thaliana miR157b stem-loop

Gene family

MIPF0000008; MIR156

Literature search

17 open access papers mention ath-MIR157b
(189 sentences)

Stem-loop

   u   ---a    -u    -a   u         -a             u  -      a   uuccuc 
5'  ggg    ggca  ugau  gug ugacagaag  uagagagcacaga ga uaagau caa      g
    |||    ||||  ||||  ||| |||||||||  ||||||||||||| || |||||| |||      c
3'  ccc    ccgu  auug  cac acugucuuc  aucucucguguuu cu auucua guu      a
   a   acua    uu    cc   u         cg             c  c      c   ucuucg 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

MIR157b is thought, like the miR156 family, to target mRNAs coding for proteins containing the Squamosa-promoter Binding Protein (SBP) box [2].

Genome context

• Coordinates (TAIR10; GCA_000001735.1): chr1: 24921086-24921217 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from ath-MIR157b

• ath-MIR157a: chr1: 24913202-24913299 [-]
• ath-MIR157b: chr1: 24921086-24921217 [+]

Database links

• RNAcentral:URS00007A67DA_3702
• miRBase Tracker:MI0000185

Mature sequence ath-miR157b-5p

• Accession: MIMAT0000173
• Previous IDs: ath-miR157b
• Sequence: 19 - uugacagaagauagagagcac - 39
• Evidence: experimental; cloned [1,3], Northern [1], 3'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

Mature sequence ath-miR157b-3p

• Accession: MIMAT0031871
• Sequence: 90 - gcucucuagccuucugucauc - 110
• Evidence: not experimental

References

1. PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2. PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3. PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4. PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5. PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6. PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).