![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR162b |
|||||
Accession | MI0000195 (change log) | ||||
Description | Arabidopsis thaliana miR162b stem-loop | ||||
Gene family | MIPF0000127; MIR162_1 | ||||
Literature search |
![]()
17 open access papers mention ath-MIR162b | ||||
Stem-loop |
g -- g c c a ------c uuu 5' gagu aagu cgcugga gcag gguu aucgauc auuc ugugaaua a |||| |||| ||||||| |||| |||| ||||||| |||| |||||||| 3' cucg uucg gcgaccu cguc ccaa uagcuag uaag acauuugu u - uc a u a c aacgaaa uuu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR162b-5p |
|
Accession | MIMAT0031877 |
Sequence |
13 - uggaggcagcgguucaucgauc - 34 |
Evidence | not experimental |
References |
|
1 |
PMID:12101121
"MicroRNAs in plants"
Genes Dev. 16:1616-1626(2002).
|
2 |
PMID:12202040
"Prediction of plant microRNA targets"
Cell. 110:513-520(2002).
|
3 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
4 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
5 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|