Stem-loop sequence ath-MIR164a

AccessionMI0000197 (change log)
DescriptionArabidopsis thaliana miR164a stem-loop
Gene family MIPF0000045; MIR164
Literature search

42 open access papers mention ath-MIR164a
(267 sentences)

Stem-loop 
         ga u   c            ca   c         ccaa    ---c   a 
5' ggguga  a cuc auguuggagaag  ggg acgugcaaa    caaa    acg a
   ||||||  | ||| ||||||||||||  ||| |||||||||    ||||    ||| a
3' cccacu  u gag uacaaccucuuc  uuc ugcacguuu    guuu    ugc u
         uc c   -            aa   a         auuc    acuc   c
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

MIR164a is thought to target mRNAs coding for NAC domain containing proteins such as Cup-Shaped Cotyledon 2 (CUC2) which is required for shoot apical meristem formation [2].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 19520752-19520864 [+]
intergenic
Database links

Mature sequence ath-miR164a

Accession MIMAT0000185
Sequence

19 -  

uggagaagcagggcacgugca

 - 39

Get sequence
Evidence experimental; cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).