![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR164b |
|||||
Accession | MI0000198 (change log) | ||||
Description | Arabidopsis thaliana miR164b stem-loop | ||||
Gene family | MIPF0000045; MIR164 | ||||
Literature search |
![]()
43 open access papers mention ath-MIR164b | ||||
Stem-loop |
a ca cauu a ---- u c --a g a a 5' gaugg gaag gggcacgug acuagcucau uaua cac cuca caca augcgu uauau ugcgg a ||||| |||| ||||||||| |||||||||| |||| ||| |||| |||| |||||| ||||| ||||| 3' cuacc cuuc cccguguac ugauugagua guau gug gagu gugu ugugua auaua guguu u a ua uucu g agua u u gug g - u |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
MIR164b is thought to target mRNAs coding for NAC domain containing proteins such as Cup-Shaped Cotyledon 2 (CUC2) which is required for shoot apical meristem formation [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR164b-3p |
|
Accession | MIMAT0031878 |
Sequence |
133 - caugugcccaucuucaccauc - 153 |
Evidence | not experimental |
References |
|
1 |
PMID:12101121
"MicroRNAs in plants"
Genes Dev. 16:1616-1626(2002).
|
2 |
PMID:12202040
"Prediction of plant microRNA targets"
Cell. 110:513-520(2002).
|
3 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
4 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
5 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
6 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|