Stem-loop sequence ath-MIR166c

Accession

MI0000203 (change log)

Description

Arabidopsis thaliana miR166c stem-loop

Gene family

MIPF0000004; MIR166

Literature search

37 open access papers mention ath-MIR166c
(297 sentences)

Stem-loop

        --u   u    a a   u  uu      cu     -    ga  aagagaaucacucgaauuaau 
5' gcgau   uag guug g gga ug  gucugg  cgagg ucau  ag                     u
   |||||   ||| |||| | ||| ||  ||||||  ||||| ||||  ||                     u
3' cgcua   auc caau c ccu ac  cggacc  gcucu agua  uc                     g
        uuc   -    c c   u  uu      ag     u    ga  ccaaaagaauuaaacaagaag 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

MIR166c, like miR165, is thought to target mRNAs coding for HD-Zip transcription factors including Phabulosa (PHB) and Phavoluta (PHV) that regulate axillary meristem initiation and leaf development [2].

Genome context

• Coordinates (TAIR10; GCA_000001735.1): chr5: 2838635-2838773 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from ath-MIR166c

• ath-MIR166c: chr5: 2838635-2838773 [+]
• ath-MIR166d: chr5: 2840622-2840734 [+]

Database links

• RNAcentral:URS00007978D5_3702
• Rfam:mir-166
• miRBase Tracker:MI0000203

Mature sequence ath-miR166c

• Accession: MIMAT0000191
• Sequence: 103 - ucggaccaggcuucauucccc - 123
• Evidence: experimental; cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

References

1. PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2. PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3. PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4. PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5. PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6. PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).