Stem-loop sequence ath-MIR166g

AccessionMI0000207 (change log)
DescriptionArabidopsis thaliana miR166g stem-loop
Gene family MIPF0000004; MIR166
Literature search

39 open access papers mention ath-MIR166g
(299 sentences)

Stem-loop 
        --uua     u  a      uu      cu     -    gg     aauuc   a 
5' gcgau     ggguu ag ggaaug  guuugg  cgagg ucau  agagu     guu a
   |||||     ||||| || ||||||  ||||||  ||||| ||||  |||||     ||| c
3' cgcua     uccaa uc ccuuac  cggacc  gcucu agua  ucuca     caa c
        uuuua     c  c      uu      ag     u    aa     aaacu   c
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

MIR166g, like miR165, is thought to target mRNAs coding for HD-Zip transcription factors including Phabulosa (PHB) and Phavoluta (PHV) that regulate axillary meristem initiation and leaf development [2].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 25504798-25504919 [+]
intergenic
Database links

Mature sequence ath-miR166g

Accession MIMAT0000195
Sequence

85 -  

ucggaccaggcuucauucccc

 - 105

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [3-4], MPSS [3], Illumina [5]

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).