Stem-loop sequence ath-MIR167a

AccessionMI0000208 (change log)
DescriptionArabidopsis thaliana miR167a stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

44 open access papers mention ath-MIR167a
(275 sentences)

Stem-loop 
   u     ac   -  u u a         c              -  -  -u     -au  u    ug    
5'  ggugc  cgg ca c g ugaagcugc agcaugaucuaauu ag cu  ucuuu   cc uugu  ugu 
    |||||  ||| || | | ||||||||| |||||||||||||| || ||  |||||   || ||||  || u
3'  ccacg  guc gu g c acuuugacg uuguacuagauuag uc ga  agaga   gg agca  acu 
   c     cu   a  u c c         c              c  u  cu     auu  u    gu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

MIR167a is thought, like miR160, to target mRNAs coding for auxin response factors, DNA binding proteins that are thought to control transcription in response to the phytohormone auxin. Transcriptional regulation is important for many of the diverse developmental responses to auxin signals, which include cell elongation, division, and differentiation in both roots and shoots [2].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 8108072-8108209 [+]
intergenic
Database links

Mature sequence ath-miR167a-5p

Accession MIMAT0000196
Previous IDsath-miR167a
Sequence

19 -  

ugaagcugccagcaugaucua

 - 39

Get sequence
Evidence experimental; cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

Mature sequence ath-miR167a-3p

Accession MIMAT0031883
Sequence

101 -  

gaucauguucgcaguuucacc

 - 121

Get sequence
Evidence not experimental

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).