Stem-loop sequence ath-MIR170

AccessionMI0000213 (change log)
DescriptionArabidopsis thaliana miR170 stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

11 open access papers mention ath-MIR170
(23 sentences)

Stem-loop 
           uc cucu         c       c      ucucuuu 
5' cgagagag  c    gauauuggc ugguuca ucagau       u
   ||||||||  |    ||||||||| ||||||| ||||||        
3' gcucucuc  g    cuauaacug gccgagu agucua       a
           cu -acu         u       u      cucaauc
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

MIR170 is thought to target mRNAs coding for GRAS domain or SCARECROW-like proteins, a family of transcription factors whose members have been implicated in radial patterning in roots, signaling by the phytohormone gibberellin, and light signaling [2].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 26411580-26411672 [-]
intergenic
Database links

Mature sequence ath-miR170-5p

Accession MIMAT0031887
Sequence

18 -  

uauuggccugguucacucaga

 - 38

Get sequence
Evidence not experimental

Mature sequence ath-miR170-3p

Accession MIMAT0000201
Previous IDsath-miR170
Sequence

59 -  

ugauugagccgugucaauauc

 - 79

Get sequence
Evidence experimental; cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4]

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).