Stem-loop sequence ath-MIR172a

AccessionMI0000215 (change log)
Previous IDsath-MIR172a1
DescriptionArabidopsis thaliana miR172a stem-loop
Gene family MIPF0000035; MIR172
Literature search

57 open access papers mention ath-MIR172a
(345 sentences)

Stem-loop 
   --u c  ug               a   cuguugauggacgguggugauuc 
5'    g ug  gcaucaucaagauuc cau                       a
      | ||  ||||||||||||||| |||                        
3'    c ac  cguaguaguucuaag gua                       c
   cgg u  gu               a   aaaguaucucuugaaacaccucu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was independently identified by two groups. Park et al. described miR172a1, found on chromosome 2 in Arabidopsis thaliana and thought to target mRNAs coding for Apetala 2 (AP2) proteins, and miR172a2 (MI0000216) [1]. These sequences have been renamed miR172a and miR172b here to match previous plant miRNA nomenclature. This sequence was referred to by Mette et al. by the internal identifier MIR123a [2], and was previously identified as MIR180a here. This sequence is not related to mouse miR-123.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 11942914-11943015 [-]
intergenic
Database links

Mature sequence ath-miR172a

Accession MIMAT0000203
Sequence

78 -  

agaaucuugaugaugcugcau

 - 98

Get sequence
Evidence experimental; cloned [1-2], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

References

1
PMID:12225663 "CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana" Park W, Li J, Song R, Messing J, Chen X Curr Biol. 12:1484-1495(2002).
2
PMID:12226481 "Short RNAs can identify new candidate transposable element families in Arabidopsis" Mette MF, van der Winden J, Matzke M, Matzke AJ Plant Physiol. 130:6-9(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).