miRBase entry: ath-MIR172a

Stem-loop ath-MIR172a


Accession
MI0000215
Description
Arabidopsis thaliana ath-MIR172a precursor miRNA

Literature search
57 open access papers mention ath-MIR172a
(367 sentences)

Sequence


ugcuguggcaucaucaagauucacaucuguugauggacgguggugauucacucuccacaaaguucucuaugaaaaugAGAAUCUUGAUGAUGCUGCAUcggc
((.(((((((((((((((((((.(((...(((.((((.(((((....))))).)))))))..(((.....))).))).))))))))))))))))))).))..

Structure
--  c                   a   -----------cug   a    c     u 
  ug uguggcaucaucaagauuc cau              uug ugga ggugg g
  || ||||||||||||||||||| |||              ||| |||| |||||  
  gc ACGUCGUAGUAGUUCUAAG gua              aac accu ucacu a
cg  U                   A   aaaguaucucuuga   -    c     u 


Annotation confidence Low
Do you think this miRNA is real?
Comments
This sequence was independently identified by two groups. Park et al. described miR172a1, found on chromosome 2 in Arabidopsis thaliana and thought to target mRNAs coding for Apetala 2 (AP2) proteins, and miR172a2 (MIR:MI0000216) [1]. These sequences have been renamed miR172a and miR172b here to match previous plant miRNA nomenclature. This sequence was referred to by Mette et al. by the internal identifier MIR123a [2], and was previously identified as MIR180a here. This sequence is not related to mouse miR-123.

Genome context
chr2: 11942914-11943015 [-]

Database links

Mature ath-miR172a

Accession MIMAT0000203
Description Arabidopsis thaliana ath-miR172a mature miRNA
Sequence 78 - AGAAUCUUGAUGAUGCUGCAU - 98
Evidence experimental
cloned [1-2], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

References

  1. PubMed ID: 16040653
    Expression of Arabidopsis MIRNA genes
    "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
    "Plant Physiol (2005) 138:2145-2154

  2. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  3. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  4. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177

  5. PubMed ID: 12226481
    Short RNAs can identify new candidate transposable element families in Arabidopsis
    "Mette MF, van der Winden J, Matzke M, Matzke AJ"
    "Plant Physiol (2002) 130:6-9

  6. PubMed ID: 12225663
    CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana
    "Park W, Li J, Song R, Messing J, Chen X"
    "Curr Biol (2002) 12:1484-1495