Stem-loop mmu-mir-182

Accession

MI0000224

Symbol

MGI: Mir182

Description

Mus musculus mmu-mir-182 precursor miRNA

Gene family

MIPF0000116; mir-182

Literature search

131 open access papers mention mmu-mir-182
(949 sentences)

Sequence

726722 reads, 1100 reads per million, 103 experiments

accauuUUUGGCAAUGGUAGAACUCACACCGguaagguaaugggacccgGUGGUUCUAGACUUGCCAACUauggu
(((((..(((((((...((((((...((((((..............))))))))))))...)))))))..)))))

Structure

     uU       UGG      UCA      uaaggu 
accau  UUGGCAA   UAGAAC   CACCGg      a
|||||  |||||||   ||||||   ||||||       
uggua  AACCGUU   AUCUUG   GUGgcc      a
     UC       CAG      ---      cagggu 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

chr6: 30165918-30165992 [-]

Clustered miRNAs

2 other miRNAs are < 10 kb from mmu-mir-182

Mature mmu-miR-182-5p

• Accession: MIMAT0000211
• Description: Mus musculus mmu-miR-182-5p mature miRNA
• Sequence: 7 - UUUGGCAAUGGUAGAACUCACACCG - 31
• Evidence: experimental ; cloned [1-3], Illumina [4,6]

Mature mmu-miR-182-3p

• Accession: MIMAT0016995
• Description: Mus musculus mmu-miR-182-3p mature miRNA
• Sequence: 50 - GUGGUUCUAGACUUGCCAACU - 70
• Evidence: experimental ; 454 [5], Illumina [6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12554859
   New microRNAs from mouse and human
   "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
   "RNA (2003) 9:175-179


3. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


4. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


5. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


6. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275