miRBase entry: mmu-mir-30e

Stem-loop mmu-mir-30e


Accession
MI0000259
Symbol
MGI: Mir30e
Description
Mus musculus mmu-mir-30e precursor miRNA
Gene family
MIPF0000005; mir-30

Literature search
194 open access papers mention mmu-mir-30e
(1209 sentences)

Sequence

2842572 reads, 4788 reads per million, 107 experiments
gggcagucuuugcuacUGUAAACAUCCUUGACUGGAAGcuguaagguguugagaggagCUUUCAGUCGGAUGUUUACAGCggcaggcugcca
.((((((((..(((.((((((((((((..(((((((((((................))))))))))))))))))))))).))))))))))).

Structure
g        uu   a            UU           guaaggu 
 ggcagucu  gcu cUGUAAACAUCC  GACUGGAAGcu       g
 ||||||||  ||| ||||||||||||  |||||||||||        
 ccgucgga  cgg GACAUUUGUAGG  CUGACUUUCga       u
a        --   C            --           ggagagu 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
chr4: 120772606-120772697 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from mmu-mir-30e
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-30e-5p

Accession MIMAT0000248
Description Mus musculus mmu-miR-30e-5p mature miRNA
Sequence 17 - UGUAAACAUCCUUGACUGGAAG - 38
Evidence experimental
cloned [2,4-5], Illumina [6-7]
Database links
Predicted targets

Mature mmu-miR-30e-3p

Accession MIMAT0000249
Description Mus musculus mmu-miR-30e-3p mature miRNA
Sequence 59 - CUUUCAGUCGGAUGUUUACAGC - 80
Evidence experimental
cloned [3,5], Illumina [6-7]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  4. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  5. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  6. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  7. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009