Stem-loop sequence cel-mir-239b

Accession

MI0000315 (change log)

Description

Caenorhabditis elegans miR-239b stem-loop

Gene family

MIPF0000135; mir-239

Literature search

4 open access papers mention cel-mir-239b
(44 sentences)

Stem-loop

   --------     aga   a          ua         a   -   a  ua 
5'         gcgac   ugc auuuuuguac  cacaaaagu cug guc uu  a
           |||||   ||| ||||||||||  ||||||||| ||| ||| ||   
3'         cguug   acg uaaaaacgug  guguuuuca gac cgg ag  g
   ucuauuuu     --a   g          ug         c   u   -  uu 

Deep sequencing

23102 reads, 53.3 reads per million, 15 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-239b was predicted by computational analysis and conservation in C. elegans and C. briggsae, and the microRNA confirmed by PCR amplification, cloning and sequencing [1]. A large scale cloning and sequencing study finds two dominant mature miRNA products: the second is 1 nt shorter at the 5' end [3].

Genome context

• Coordinates (WBcel235; GCA_000002985.3): chrX: 11791302-11791399 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from cel-mir-239b

• cel-mir-239a: chrX: 11792445-11792542 [+]
• cel-mir-239b: chrX: 11791302-11791399 [-]

Database links

• RNAcentral:URS0000506BCE_6239
• miRBase Tracker:MI0000315

Mature sequence cel-miR-239b-5p

• Accession: MIMAT0000295
• Previous IDs: cel-miR-239b
• Sequence: 16 - uuuguacuacacaaaaguacug - 37
• Deep sequencing: 21907 reads, 14 experiments
• Evidence: experimental; cloned [3], Illumina [4], CLIPseq [5]
• Database links:
  • RNAcentral:URS00005BB985_6239
• Predicted targets:
  • TargetScanWorm:cel-miR-239b
  • microrna.org:cel-miR-239b-5p

Mature sequence cel-miR-239b-3p

• Accession: MIMAT0015115
• Previous IDs: cel-miR-239b*
• Sequence: 58 - gcacuuuuguggugugcaaaaa - 79
• Deep sequencing: 36 reads, 9 experiments
• Evidence: experimental; CLIPseq [5]
• Database links:
  • RNAcentral:URS0000587B0A_6239
• Predicted targets:
  • microrna.org:cel-miR-239b-3p

References

1. PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2. PMID:15317971 "Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification" Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB RNA. 10:1309-1322(2004).
3. PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4. PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
5. PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).