![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence cel-mir-248 |
|||||
Accession | MI0000324 (change log) | ||||
Description | Caenorhabditis elegans miR-248 stem-loop | ||||
Gene family | MIPF0000262; mir-248 | ||||
Literature search |
![]()
2 open access papers mention cel-mir-248 | ||||
Stem-loop |
uuucccg - - cu a g -a - a u uac 5' gc ugc aa acggu agcg uaucc gc cg ugu uucaa u || ||| || ||||| |||| ||||| || || ||| ||||| 3' cg acg uu uguua ucgc auagg cg gc aca aaguu g ------- u c uu c a ca u - u uac |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence cel-miR-248 |
|
Accession | MIMAT0000304 |
Sequence |
60 - auacacgugcacggauaacgcuca - 83 |
Deep sequencing | 60963 reads, 17 experiments |
Evidence | experimental; cloned [1-2], Northern [1], Illumina [3], CLIPseq [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12672692
"The microRNAs of Caenorhabditis elegans"
Genes Dev. 17:991-1008(2003).
|
2 |
PMID:17174894
"Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans"
Cell. 127:1193-1207(2006).
|
3 | |
4 |
PMID:20062054
"Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans"
Nat Struct Mol Biol. 17:173-179(2010).
|