Stem-loop sequence cel-mir-248

AccessionMI0000324 (change log)
DescriptionCaenorhabditis elegans miR-248 stem-loop
Gene family MIPF0000262; mir-248
Literature search

2 open access papers mention cel-mir-248
(12 sentences)

Stem-loop 
   uuucccg  -   -  cu     a    g     -a  -  a   u     uac 
5'        gc ugc aa  acggu agcg uaucc  gc cg ugu uucaa   u
          || ||| ||  ||||| |||| |||||  || || ||| |||||    
3'        cg acg uu  uguua ucgc auagg  cg gc aca aaguu   g
   -------  u   c  uu     c    a     ca  u  -   u     uac
Get sequence
Deep sequencing
60964 reads, 129 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [2].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 2262373-2262470 [-]
intergenic
Database links

Mature sequence cel-miR-248

Accession MIMAT0000304
Sequence

60 -  

auacacgugcacggauaacgcuca

 - 83

Get sequence
Deep sequencing60963 reads, 17 experiments
Evidence experimental; cloned [1-2], Northern [1], Illumina [3], CLIPseq [4]
Database links
Predicted targets

References

1
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
4
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).