Stem-loop sequence cel-mir-249

Accession

MI0000325 (change log)

Description

Caenorhabditis elegans miR-249 stem-loop

Gene family

MIPF0000263; mir-249

Literature search

1 open access papers mention cel-mir-249
(6 sentences)

Stem-loop

   aua     gaa     a       a    c   uu     -   ca    c 
5'    cucuu   cgacu gcaacgc caaa guc  cugug cga  acau u
      |||||   ||||| ||||||| |||| |||  ||||| |||  ||||  
3'    gagaa   gcuga cguugcg guuu cag  gacac guu  ugua g
   aag     --a     c       a    u   --     u   --    a 

Deep sequencing

647 reads, 0 reads per million, 15 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [2].

Genome context

• Coordinates (WBcel235; GCA_000002985.3): chrX: 3006440-3006536 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from cel-mir-249

• cel-mir-249: chrX: 3006440-3006536 [-]
• cel-mir-785: chrX: 3004668-3004761 [+]
• cel-mir-359: chrX: 3004291-3004400 [+]

Database links

• RNAcentral:URS0000445821_6239
• miRBase Tracker:MI0000325

Mature sequence cel-miR-249-5p

• Accession: MIMAT0020338
• Previous IDs: cel-miR-249*
• Sequence: 17 - agcaacgcacaaacgucuucugug - 40
• Deep sequencing: 7 reads, 6 experiments
• Evidence: experimental; Illumina [4]

Mature sequence cel-miR-249-3p

• Accession: MIMAT0000305
• Previous IDs: cel-miR-249
• Sequence: 61 - ucacaggacuuuugagcguugcc - 83
• Deep sequencing: 633 reads, 15 experiments
• Evidence: experimental; cloned [1-2], Illumina [3-4]
• Database links:
  • RNAcentral:URS00004386AB_6239
• Predicted targets:
  • TargetScanWorm:cel-miR-249
  • microrna.org:cel-miR-249-3p

References

1. PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2. PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3. PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
4. PMID:21307183 "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" Warf MB, Johnson WE, Bass BL RNA. 17:563-577(2011).