Stem-loop sequence cel-mir-259

Accession

MI0000336 (change log)

Description

Caenorhabditis elegans miR-259 stem-loop

Gene family

MIPF0000299; mir-259

Literature search

2 open access papers mention cel-mir-259
(57 sentences)

Stem-loop

   ---uc        --a       a        -  u    u   a   ucuuu 
5'      agucauug   aacgagu aaucucau cc aauc ggu gca     c
        ||||||||   ||||||| |||||||| || |||| ||| |||      
3'      ucagugau   uuguuca uuagggua gg uuag cca cgu     g
   uuuuu        aaa       g        c  u    -   c   uccaa 

Deep sequencing

2757 reads, 250 reads per million, 16 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-259 was predicted by computational analysis and conservation in C. elegans and C. briggsae, and the microRNA confirmed by PCR amplification, cloning and sequencing [1].

Genome context

• Coordinates (WBcel235; GCA_000002985.3): chrV: 10539025-10539125 [-]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS000024924B_6239
• miRBase Tracker:MI0000336

Mature sequence cel-miR-259-5p

• Accession: MIMAT0000314
• Previous IDs: cel-miR-259
• Sequence: 19 - aaaucucauccuaaucugguagca - 42
• Deep sequencing: 2101 reads, 16 experiments
• Evidence: experimental; cloned [1-3], Illumina [4,6], CLIPseq [5]
• Database links:
  • RNAcentral:URS00004466D7_6239
• Predicted targets:
  • TargetScanWorm:cel-miR-259
  • microrna.org:cel-miR-259-5p

Mature sequence cel-miR-259-3p

• Accession: MIMAT0020342
• Previous IDs: cel-miR-259*
• Sequence: 57 - ccaccgauuuggcaugggauugac - 80
• Deep sequencing: 654 reads, 13 experiments
• Evidence: experimental; Illumina [6]
• Database links:
  • RNAcentral:URS00002A44D4_6239

References

1. PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
2. PMID:15317971 "Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification" Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB RNA. 10:1309-1322(2004).
3. PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4. PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
5. PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6. PMID:21307183 "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" Warf MB, Johnson WE, Bass BL RNA. 17:563-577(2011).