Stem-loop sequence dme-mir-279

Accession

MI0000363 (change log)

Description

Drosophila melanogaster miR-279 stem-loop

Gene family

MIPF0000184; mir-279

Literature search

16 open access papers mention dme-mir-279
(221 sentences)

Stem-loop

   ggaauucau         u          g     c  uguu     uug   u 
5'          acuacuguu uuagugggug ggguc ag    ucaca   auu u
            ||||||||| |||||||||| ||||| ||    |||||   ||| c
3'          ugauggcaa aauuacucac ccuag uc    agugu   uga u
   -------cu         u          a     a  ----     uua   u 

Deep sequencing

438713 reads, 1.23e+04 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-279 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the ends of the excised miRNA by cloning.

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr3R: 29215585-29215684 [+]
• Overlapping transcripts:

  sense

  FBtr0085391 ; CR31044-RA; exon 1

  FBtr0303426 ; CR31044-RB; intron 2

  FBtr0303427 ; CR31044-RC; exon 2

Clustered miRNAs

< 10kb from dme-mir-279

• dme-mir-279: chr3R: 29215585-29215684 [+]
• dme-mir-996: chr3R: 29217184-29217280 [+]

Database links

• RNAcentral:URS00007AA45E_7227
• miRBase Tracker:MI0000363

Mature sequence dme-miR-279-5p

• Accession: MIMAT0020807
• Sequence: 22 - aguggguggggguccaguguuucaca - 47
• Deep sequencing: 2182 reads, 45 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS0000266946_7227

Mature sequence dme-miR-279-3p

• Accession: MIMAT0000341
• Previous IDs: dme-miR-279
• Sequence: 67 - ugacuagauccacacucauuaa - 88
• Deep sequencing: 436481 reads, 49 experiments
• Evidence: experimental; Northern [1], cloned [2], 454 [3-4], Illumina [4]
• Database links:
  • RNAcentral:URS0000003085_7227
• Predicted targets:
  • TargetScanFly:dme-miR-279
  • microrna.org:dme-miR-279-3p

References

1. PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
2. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).