WARNING: This summary was generated by AI. Dme-mir-100 is a mature microRNA in Drosophila melanogaster, with the "dme" prefix indicating the organism and "mir-100" being a sequentially assigned number [PMC4718083]. It is part of a microRNA gene naming convention, with dme-mir-100 and dme-mir-100* representing the guide and passenger strands, respectively [PMC3965103]. This microRNA has been selected for study due to its orthology with human miRNAs and its relevance in laboratory data [PMC5090246]. Dme-mir-100 shares extensive overall similarity with human miRNAs hsa-miR-10a and hsa-miR-10b, despite some mismatches at the 5′ end [PMC2486268]. The expression of dme-mir-100 is subject to complex post-transcriptional regulation, as evidenced by its low correlation coefficients when compared to other miRNAs* in expression profiles [PMC3150300]. Additionally, tissue-specific A-to-I editing has been observed for dme-mir-100 in male heads and Kc167 cell line, indicating a level of regulation during its maturation process [PMC3150300]. The correlation analysis within the 100~125 cluster suggests intricate regulatory interactions involving dme-mir-125 and dme-let-7 as well as post-transcriptional modifications like A-to-I editing being potential regulatory mechanisms for dme-mir-100 [PMC3150300]. This microRNA has also been implicated in metamorphosis development in Drosophila melanogaster alongside other miRNAs such as Dme-let7 and Dme-miR125 [PMC5689003].
-------------------c a AA AU AA - u uuu
cauu acaga CCCGUAA CCG CUUGUG c g u
|||| ||||| ||||||| ||| |||||| | |
guaa uguCU GGGUAUU GGC GAACau g c a
acgguuuuuggucaacaaac c GA AC CA u u uau
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Accession | MIMAT0000357 |
| Description | Drosophila melanogaster dme-miR-100-5p mature miRNA |
| Sequence | 12 - AACCCGUAAAUCCGAACUUGUG - 33 |
| Evidence |
experimental
Northern [1,3], 454 [4-5], Illumina [5] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0020818 |
| Description | Drosophila melanogaster dme-miR-100-3p mature miRNA |
| Sequence | 51 - CAAGACCGGCAUUAUGGGAGUC - 72 |
| Evidence | not_experimental |
| Database links |
|
|