miRBase entry: mmu-mir-301a

Stem-loop mmu-mir-301a


Accession
MI0000401
Description
Mus musculus mmu-mir-301a precursor miRNA
Gene family
MIPF0000034; mir-130

Literature search
51 open access papers mention mmu-mir-301a
(652 sentences)

Sequence

139890 reads, 1108 reads per million, 107 experiments
ccugcuaacggcuGCUCUGACUUUAUUGCACUACUguacuuuacagcgagCAGUGCAAUAGUAUUGUCAAAGCauccgcgagcagg
((((((..(((.((((.((((.((((((((((.((((........)).)).))))))))))....)))).)))).)))..))))))

Structure
      aa   c    C    ---U          A  -  acu 
ccugcu  cgg uGCU UGAC    UUAUUGCACU CU gu   u
||||||  ||| |||| ||||    |||||||||| || ||    
ggacga  gcc aCGA ACUG    GAUAACGUGA ga cg   u
      gc   u    A    UUAU          C  g  aca 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr11: 87113004-87113089 [+]

Database links

Mature mmu-miR-301a-5p

Accession MIMAT0017008
Description Mus musculus mmu-miR-301a-5p mature miRNA
Sequence 14 - GCUCUGACUUUAUUGCACUACU - 35
Evidence experimental
454 [5], Illumina [6]
Database links
Predicted targets

Mature mmu-miR-301a-3p

Accession MIMAT0000379
Description Mus musculus mmu-miR-301a-3p mature miRNA
Sequence 51 - CAGUGCAAUAGUAUUGUCAAAGC - 73
Evidence experimental
cloned [1-3], Northern [1], Illumina [4,6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275