miRBase entry: mmu-mir-34b

Stem-loop mmu-mir-34b


Accession
MI0000404
Symbol
MGI: Mir34b
Description
Mus musculus mmu-mir-34b precursor miRNA
Gene family
MIPF0000039; mir-34

Literature search
208 open access papers mention mmu-mir-34b
(1296 sentences)

Sequence

48684 reads, 3047 reads per million, 89 experiments
gugcucgguuuguAGGCAGUGUAAUUAGCUGAUUGUagugcggugcugacAAUCACUAACUCCACUGCCAUCaaaacaaggcac
(((((..((((...(((((((...((((.((((((((((.....))).)))))))))))...)))))))....))))..)))))

Structure
     cg    -guA       UAA    C       -   g 
gugcu  guuu    GGCAGUG   UUAG UGAUUGU agu c
|||||  ||||    |||||||   |||| ||||||| ||| g
cacgg  caaa    CCGUCAC   AAUC ACUAAca ucg g
     aa    aCUA       CUC    -       g   u 


Annotation confidence High
Do you think this miRNA is real?
Comments
Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells [1], and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) and miR-34a (MIR:MI0000584) to clarify homology with human sequences. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr9: 51103562-51103645 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-34b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-34b-5p

Accession MIMAT0000382
Description Mus musculus mmu-miR-34b-5p mature miRNA
Sequence 14 - AGGCAGUGUAAUUAGCUGAUUGU - 36
Evidence experimental
cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-34b-3p

Accession MIMAT0004581
Description Mus musculus mmu-miR-34b-3p mature miRNA
Sequence 51 - AAUCACUAACUCCACUGCCAUC - 72
Evidence experimental
cloned [2], Illumina [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009