Hsa-mir-23b is a microRNA that has been found to be present in the saliva of patients diagnosed with intraductal papillary mucinous neoplasm (IPMN) and could potentially be used in the management of IPMN [PMC4486170]. In a study, 16 miRNAs were found to be significantly up-regulated, including hsa-miR-32, hsa-miR-19a, hsa-miR-18b, hsa-miR-96, hsa-miR-183, hsa-miR-130b, hsa-miR-182, hsa-miR-18a, hsa-miR-375, hsa-miR-106a, hsa-miR-106b, hsa-mir-425, hsa-mir17a and 25 [PMC5788610]. Additionally 13 miRNAs were significantly down-regulated including has miRNA 100 and has miRNA 23a [PMC5788610]. HSA mir23b is also down-regulated in IPMN patients [PMC5788610]. These findings suggest that the dysregulation of these miRNAs may play a role in the development and progression of IPMN. Further research is needed to fully understand the functional significance of these dysregulated miRNAs and their potential as diagnostic or prognostic markers for IPMN. The study provides valuable insights into the potential use of saliva-based biomarkers for decision making in IPMN management. The identification of specific dysregulated miRNAs such as has mir23b could potentially lead to improved diagnostic and therapeutic strategies for patients with IPMN [PMC4486170] [PMC5788610].
c u c - c u -- - C gugacu ucagg g uc ugg ugc UGG GUUCCUGGCA UG UGAUUU u ||||| | || ||| ||| ||| |||||||||| || |||||| gguuc c ag acc acg ACC UAGGGACCGU AC ACUAaa a c - - c a C AU U - auuaga
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004587 |
Description | Homo sapiens hsa-miR-23b-5p mature miRNA |
Sequence | 20 - UGGGUUCCUGGCAUGCUGAUUU - 41 |
Evidence |
experimental
cloned [3] |
Database links | |
Predicted targets |
Accession | MIMAT0000418 |
Description | Homo sapiens hsa-miR-23b-3p mature miRNA |
Sequence | 58 - AUCACAUUGCCAGGGAUUACCAC - 80 |
Evidence |
experimental
cloned [2-3] |
Database links | |
Predicted targets |
|