![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-30b |
||||||
Accession | MI0000441 (change log) | |||||
Symbol | HGNC:MIR30B | |||||
Description | Homo sapiens miR-30b stem-loop | |||||
Gene family | MIPF0000005; mir-30 | |||||
Literature search |
![]()
398 open access papers mention hsa-mir-30b | |||||
Stem-loop |
a uu cau u -a uaaua 5' ccaag ucaguu guaaacaucc ac cucagcug c ||||| |||||| |||||||||| || |||||||| 3' gguuc agucga cauuuguagg ug gggucggu a a -- cuu - ga uaggu |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-30b-5p |
|
Accession | MIMAT0000420 |
Previous IDs | hsa-miR-30b |
Sequence |
17 - uguaaacauccuacacucagcu - 38 |
Deep sequencing | 1110974 reads, 159 experiments |
Evidence | experimental; cloned [2-3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-30b-3p |
|
Accession | MIMAT0004589 |
Previous IDs | hsa-miR-30b* |
Sequence |
55 - cugggagguggauguuuacuuc - 76 |
Deep sequencing | 7535 reads, 155 experiments |
Evidence | experimental; cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|