miRBase entry: hsa-mir-191

Stem-loop hsa-mir-191


Accession
MI0000465
Symbol
HGNC: MIR191
Description
Homo sapiens hsa-mir-191 precursor miRNA mir-191
Gene
family?
RF00764; mir-191

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR191 is a microRNA (miRNA) that has been identified as notably expressed across various tumor types and is considered a key miRNA ortholog among those that are mutually abundant in these tumors [PMC9210832]. In the context of malignant hyperthermia (MHT), the concentration of MIR191 in patients may serve as a valuable biomarker, potentially aiding in the decision-making process regarding the necessity for an initial cranial computed tomography (CCT) scan [PMC7430915]. Research has also been conducted on modified peptide nucleic acids (MEPNAs) for MIR191, with four different MEPNAs being synthesized, each with varying gap sizes of unmodified nucleotide units, to explore their potential applications [PMC4005664].

Literature search
166 open access papers mention hsa-mir-191
(853 sentences)

Sequence

1515619 reads, 6473 reads per million, 146 experiments
cggcuggacagcgggCAACGGAAUCCCAAAAGCAGCUGuugucuccagagcauuccaGCUGCGCUUGGAUUUCGUCCCCugcucuccugccu
.(((.(((.((((((..(((((((((.((..(((((((.(((.......)))...)))))))..)))))))))))..)))))).))).))).

Structure
c   u   c      CA         C  AA       --u   cu 
 ggc gga agcggg  ACGGAAUCC AA  GCAGCUG   ugu  c
 ||| ||| ||||||  ||||||||| ||  |||||||   |||  c
 ccg ccu ucguCC  UGCUUUAGG UU  CGUCGac   acg  a
u   u   c      CC         -  CG       cuu   ag 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA was later confirmed in human HL-60 leukemia cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chr3: 49020618-49020709 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-191
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-191 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-191-5p

Accession MIMAT0000440
Description Homo sapiens hsa-miR-191-5p mature miRNA
Sequence 16 - CAACGGAAUCCCAAAAGCAGCUG - 38
Evidence experimental
cloned [2-5]
Database links
Predicted targets

Mature hsa-miR-191-3p

Accession MIMAT0001618
Description Homo sapiens hsa-miR-191-3p mature miRNA
Sequence 58 - GCUGCGCUUGGAUUUCGUCCCC - 79
Evidence experimental
cloned [2-4]
Database links
Predicted targets

References

  1. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  5. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706