miRBase entry: hsa-mir-138-1

Stem-loop hsa-mir-138-1


Accession
MI0000476
Symbol
HGNC: MIR138-1
Description
Homo sapiens hsa-mir-138-1 precursor miRNA mir-138
Gene
family?
RF00671; mir-138

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR138-1 is a micro-RNA encoded by a specific genomic locus on chromosome 9, distinct from its homolog MIR138-2, and is implicated in various biological processes [PMC6836737]. It is expressed in the nervous system and has been identified as one of the brain-enriched microRNA-coding long non-coding RNAs (lncRNAs) [PMC4468152]. Notably, MIR138-1 does not appear to be associated with a deficit in Schwann cell (SC) differentiation, as indicated by studies on MIR138-1 conditional knockout (cKO) nerves [PMC5830491]. In the context of ischemic chronic heart disease (iCHD), Mendelian randomization analysis has identified DNA methylation levels at two CpG sites near MIR138-1 that may exert causal effects on the disease [PMC8501606]. Additionally, this micro-RNA is situated in an intergenic region with no other nearby annotated miRNAs or mRNAs, suggesting a unique regulatory role [PMC4057207]. Research using Bru-seq technology has revealed that the primary transcription start site (TSS) for MIR138-1 may be located significantly upstream from its annotated mature DNA sequence [PMC4675984]. Furthermore, quantitative RT-PCR results support an accumulation of miRNA 5′ leader sequences relative to primary miRNA for MIR138-1, indicating post-transcriptional regulatory mechanisms at play [PMC4057207].

Literature search
228 open access papers mention hsa-mir-138-1
(1564 sentences)

Sequence

87542 reads, 366 reads per million, 82 experiments
cccuggcauggugugguggggcAGCUGGUGUUGUGAAUCAGGCCGuugccaaucagagaacgGCUACUUCACAACACCAGGGCCacaccacacuacagg
.((((...((((((((((.(((..(((((((((((((...(((((((..(.....)..)))))))..))))))))))))).))).))))))))))))))

Structure
c    gca          g   AG             UCA       gc a 
 ccug   ugguguggug ggc  CUGGUGUUGUGAA   GGCCGuu  c a
 ||||   |||||||||| |||  |||||||||||||   |||||||  | u
 ggac   aucacaccac CCG  GACCACAACACUU   UCGgcaa  g c
-    ---          a   -G             -CA       ga a 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Expression in human was later validated by cloning [2].

Genome context
chr3: 44114212-44114310 [+]

Disease association
hsa-mir-138-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-138-5p

Accession MIMAT0000430
Description Homo sapiens hsa-miR-138-5p mature miRNA
Sequence 23 - AGCUGGUGUUGUGAAUCAGGCCG - 45
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-138-1-3p

Accession MIMAT0004607
Description Homo sapiens hsa-miR-138-1-3p mature miRNA
Sequence 63 - GCUACUUCACAACACCAGGGCC - 84
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043